Based on molecular data and skull features, what reptile(s) has an independent lineage from all other reptiles?
A. crocodiles
B. lizards
C. snakes
D. turtles
E. lizards and crocodiles have independent lineages
Answer: D
You might also like to view...
Riboswitches are alternative RNA structures mediated by the binding of molecules to the RNA. One example of a riboswitch is the intrinsic terminator hairpin (stem-loop) structure that may form in specific sites of newly transcribed RNA
This stable RNA hairpin, if followed by 4–8 uridine residues at the 3' end, is a signal for transcriptional termination of that RNA. The termination of transcription involves interactions of the RNA polymerase, the hairpin, and the template strand sequence. RNA polymerase reads the DNA template strand 3' to 5' while synthesizing the new (nascent) RNA strand 5' to 3'. Which of the following DNA sequences, when transcribed, will most likely form an intrinsic transcription termination RNA structure? A. 3' AAAAAAUUUUUU TTTTT 5' B. 3' ACCCCCATGGGGGAAAAAA 5' C. 3' GGGGGGTTTCCCCCTTTTTT 5' D. 3' ACGACCCGGACGGGGGGG 5' E.3' TTTTTTCCCCCCAAAGGGGGG 5'
Parasitoids reduce the host population by ________
a. having their larvae steal the host's nutrients and eventually killing the host during larval development b. outcompeting the host population for breeding sites and eventually killing the host during larval development c. killing the host's offspring and outcompeting the host population for breeding sites d. having larvae steal the host's nutrients and making the host sterile e. having the larvae steal the host's nutrients and killing the host's offspring
A higher protein concentration within the distal portion of capillaries draws water into them through the process of
A. diffusion. B. facilitated diffusion. C. active transport. D. filtration. E. osmosis.
The envelope of the HIV virus is actually part of the host cell plasma membrane.
Answer the following statement true (T) or false (F)