The sequence of gene B from another baby frog who is homozygous for allele b2 is shown. What effect does the mutation in allele b2 have on the protein?

5? AGGTCGCATAAATGTTCCTGTAATTTGG… 3?


A) Allele b2 has a frameshift mutation—a deletion of one nucleotide resulting in a frameshift that changes all amino acids from that point on.
B) Allele b2 has a deletion of one nucleotide outside of the coding region and there is no effect on the protein.
C) Allele b2 has a missense mutation—a nucleotide substitution that changes one amino acid to another.
D) Allele b2 has a nonsense mutation—a nucleotide substitution that forms a stop codon.
E) Allele b2 has a silent mutation—a nucleotide substitution that does not change the protein.


D) Allele b2 has a nonsense mutation—a nucleotide substitution that forms a stop codon.

Biology & Microbiology

You might also like to view...

True or False: Traits favored by sexual selection are the same traits favored by natural selection

A. true B. false

Biology & Microbiology

Phospholipids contain ____________________ tails that are repelled by water. Fill in the blank(s) with the appropriate word(s)

Biology & Microbiology

The difference in cell wall structure of Mycobacterium and Nocardia compared to the typical gram-positive bacterial cell wall structure is

A. the presence of more peptidoglycan. B. the presence of lipopolysaccharide. C. the predominance of unique, waxy lipids. D. the rapid decolorization during staining. E. All of these choices are correct.

Biology & Microbiology

Mendellan Genetics

What will be an ideal response?

Biology & Microbiology