HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA
A) 0 times
B) 1 time
C) 2 times
D) 3 times
C
Biology & Microbiology
You might also like to view...
In the creation of a DNA profile, _____ are typically used
a. minisatellites b. short tandem repeats c. introns d. exons e. plasmids
Biology & Microbiology
Which is the most ancient human species known?
1.Homo ergaster 2.Homo erectus 3.Homo habilis 4.Homo sapiens
Biology & Microbiology
The process of photosynthesis in plants occurs in specialized cells within the leaf called ________ cells
Fill in the blank(s) with correct word
Biology & Microbiology
The first epidemiologist who studied the cholera outbreak in London was
A) John Snow B) Alexander Flemming C) Robert Koch D) Jonas Salk
Biology & Microbiology