HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

A) 0 times
B) 1 time
C) 2 times
D) 3 times


C

Biology & Microbiology

You might also like to view...

In the creation of a DNA profile, _____ are typically used

a. minisatellites b. short tandem repeats c. introns d. exons e. plasmids

Biology & Microbiology

Which is the most ancient human species known?

1.Homo ergaster 2.Homo erectus 3.Homo habilis 4.Homo sapiens

Biology & Microbiology

The process of photosynthesis in plants occurs in specialized cells within the leaf called ________ cells

Fill in the blank(s) with correct word

Biology & Microbiology

The first epidemiologist who studied the cholera outbreak in London was

A) John Snow B) Alexander Flemming C) Robert Koch D) Jonas Salk

Biology & Microbiology