Ticks feed while attached to the host's surface. They are ____
a. endoparasites
b. ectoparasites
c. parasitoids
d. brood parasites
e. external parasites
b
You might also like to view...
Which of the following includes a tandem duplication within the sequence GTCCTTATTCA?
A) GTCCTGATTATTCA B) GTCCACTTATT C) GTCCTTATTCAACTTATTCCTG D) GTCCTTATATTCA
________ provide valuable flood control because they can hold large volumes of water
Fill in the blank(s) with correct word
DNA is found in every cell of an organism. What subset of DNA changes would be most useful to molecular biologists to determine evolutionary relationships?
A) DNA changes that occur in genes specific to organisms in one kingdom B) DNA changes in genes that are shared by a common ancestor C) DNA changes in genes that occur in body cells and cannot be passed to offspring D) DNA changes in genes that do not generally code for any function
One of the questions early geneticists had to answer was how only four nucleotides can specify placement of 20 amino acids in proteins. Today we know that _________, a sequence of three adjacent nucleotides, determine the insertion of a specific amino acid in a polypeptide chain
a) codon b) karyotype c) reverse transcritption d) glycerol