A pharmaceutical company develops a drug inhibiting mitosis of sporozoites in an effort to prevent malaria. How would this affect the next step of the infection cycle of Plasmodium falciparum?
A. Infected red blood cells would not attach to the linings of capillaries.
B. Merozoites would not be produced.
C. Gametes would not be produced.
D. Infected red blood cells would not burst.
E. Gametocytes would not be produced.
Answer: B
You might also like to view...
Which of the following includes a tandem duplication within the sequence GTCCTTATTCA?
A) GTCCTGATTATTCA B) GTCCACTTATT C) GTCCTTATTCAACTTATTCCTG D) GTCCTTATATTCA
The black dots that cover strawberries are actually individual fruits. The fleshy and tasty portion of a strawberry derives from the receptacle of a flower with many separate carpels. Therefore, a strawberry is _____
A) both a multiple fruit and an aggregate fruit B) both a multiple fruit and an accessory fruit C) both an aggregate fruit and an accessory fruit D) a simple fruit with many seeds
Experiments with bacteria and ____________________ offered solid evidence that deoxyribonucleic acid (DNA), not protein, is the hereditary material.
Fill in the blank(s) with the appropriate word(s).
Irradiated mammalian cells usually stop dividing and arrest at a G1 checkpoint. Place the following events in the order in which they occur
A. production of p21 B. DNA damage C. inhibition of cyclin–Cdk complexes D. accumulation and activation of p53