You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Select the primers that should be used.5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
A. 5' - AGGGC- 3' and 5' -GATTG- 3'.
B. 5' -GTTAG -3' and 5' -ATCCC -3'.
C. 3' -CAATC- 5' and 3' -GCCCT- 5'.
D. 5' -CAATC- 3' and 5' -GCCCT- 3'.
E. 3' - AGGGC- 5' and 3' -GATTG- 5'.
Answer: D
You might also like to view...
Which cells are alive at maturity?
a. sieve elements b. vessel members c. tracheids d. vessel members and tracheids e. sieve elements and vessel members
The waggle dance of a bee indicates to other bees in the hive the direction of food.
Answer the following statement true (T) or false (F)
Which of the following is a waterborne pathogen that causes severe diarrhea?
A) Entamoeba histolytica B) Naegleria fowleri C) Campylobacter jejuni D) Toxoplasma gondii E) Gonyaulax species
Specific amino acids are attached to tRNA molecules by
A. deactivating enzymes. B. aminoacyl-tRNA synthetases. C. anticodons. D. hydrogen bonds. E. initiation factors.