The gonads produce steroids. The specific steroid-producing organelle in gonad cells is

A. ribosomes.
B. lysosomes.
C. smooth endoplasmic reticulum.
D. mitochondria.
E. contractile vacuole.


C. smooth endoplasmic reticulum.

Biology & Microbiology

You might also like to view...

Molecular biologists use restriction enzymes to amplify a specific section of DNA within the genome

Indicate whether the statement is true or false

Biology & Microbiology

Baby frog #1 was born with brown skin instead of the normal green. DNA was collected from the baby frog and the DNA sequence of part of gene B was determined using the primer 5? ACTCAAGCACAGGTCG 3?. What is the entire sequence of the smallest DNA fragment produced in the sequencing reaction? (See diagram for sequencing data.)



A) C
B) 5? ACTCAAGCACAGGTCGC
C) 5? AGGTCGG
D) 5? CATAAATGTCCTGTTATTTGG
E) 5? CGACCTG

Biology & Microbiology

How would you design an experiment to test whether a transduction event occurred between two different bacterial strains?

What will be an ideal response?

Biology & Microbiology

Aphids are small insects that insert their mouthparts into a plant to obtain phloem sap. Which would be the best way to determine if aphids must actively draw phloem sap into their digestive tract or if hydrostatic pressure in the phloem tube could force

the sap into them? A) Isolate a phloem tube from a plant, allow an aphid to insert its mouthparts, and see if the aphid can still take up sap from it. B) Measure relative rates of sugar manufacture in leaves with and without aphids. C) Insert mouthparts removed from an aphid, without including the digestive tract, into phloem sap and see if sap keeps flowing through them.

Biology & Microbiology