You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Select the primers that should be used.

5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'

A. 5' - AGGGC- 3' and 5' -GATTG- 3'.
B. 5' -CAATC- 3' and 5' -GCCCT- 3'.
C. 3' -CAATC- 5' and 3' -GCCCT- 5'.
D. 3' - AGGGC- 5' and 3' -GATTG- 5'.
E. 5' -GTTAG -3' and 5' -ATCCC -3'.


B. 5' -CAATC- 3' and 5' -GCCCT- 3'.

Biology & Microbiology

You might also like to view...

Nematodes and rotifers have a body cavity that is

(a) called a coelom. (b) called a pseudocoelom. (c) completely lined by tissues derived from mesoderm. (d) both a and c.

Biology & Microbiology

All invertebrates have phagocytic cells, but lack antibodies

Indicate whether the statement is true or false.

Biology & Microbiology

The enzyme responsible for breaking down

alcohol is a. alcohol methylase. b. alcohol polyphosphorylase. c. hydroxyl alcoholgenase. d. transmethylogenase. e. alcohol dehydrogenase

Biology & Microbiology

Which of the following explains cohesins?

a. Cohesins are lipids that help separate sister chromatids. b. Cohesins are lipids that hold sister chromatids together. c. Cohesins are proteins that help separate sister chromatids. d. Cohesins are proteins that hold sister chromatids together

Biology & Microbiology