You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Select the primers that should be used.
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'
3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
A. 5' - AGGGC- 3' and 5' -GATTG- 3'.
B. 5' -CAATC- 3' and 5' -GCCCT- 3'.
C. 3' -CAATC- 5' and 3' -GCCCT- 5'.
D. 3' - AGGGC- 5' and 3' -GATTG- 5'.
E. 5' -GTTAG -3' and 5' -ATCCC -3'.
B. 5' -CAATC- 3' and 5' -GCCCT- 3'.
You might also like to view...
Nematodes and rotifers have a body cavity that is
(a) called a coelom. (b) called a pseudocoelom. (c) completely lined by tissues derived from mesoderm. (d) both a and c.
All invertebrates have phagocytic cells, but lack antibodies
Indicate whether the statement is true or false.
The enzyme responsible for breaking down
alcohol is a. alcohol methylase. b. alcohol polyphosphorylase. c. hydroxyl alcoholgenase. d. transmethylogenase. e. alcohol dehydrogenase
Which of the following explains cohesins?
a. Cohesins are lipids that help separate sister chromatids. b. Cohesins are lipids that hold sister chromatids together. c. Cohesins are proteins that help separate sister chromatids. d. Cohesins are proteins that hold sister chromatids together