Which of the following would not increase population size?
a. natality
b. mortality
c. immigration
d. r greater than 1
e. r greater than 2
B
You might also like to view...
Miller and Urey's experiment was ground breaking because
A. This was the first example of an experiment being used that inserted oxygen into the prebiotic soup. B. This was the first attempt to apply scientific experimentation to the quest of understanding the origin of life. C. They hypothesized what could have been the first molecules formed, but they could not demonstrate this in a scientific experiment. D. This was the last experiment that used boiling water as a trigger mechanism for the production of macromolecules. E. This was the first experiment based on the theory that organic carbon actually arrived from outer space.
Which of the following generally causes stomata to close?
a. release of abscisic acid by the roots b. a drop in CO2 concentration in leaf air spaces c. exposure to red light d. a drop in O2 concentration in leaf air spaces e. an increase in water in the soil
Baby frog #1 was born with brown skin instead of the normal green. DNA was collected from the baby frog and the DNA sequence of part of gene B was determined using the primer 5? ACTCAAGCACAGGTCG 3?. What is the entire sequence of the smallest DNA fragment produced in the sequencing reaction? (See diagram for sequencing data.)
A) C
B) 5? ACTCAAGCACAGGTCGC
C) 5? AGGTCGG
D) 5? CATAAATGTCCTGTTATTTGG
E) 5? CGACCTG
__________ selection favors intermediate forms of a trait where __________ selection favors extreme forms. Fill in the blank(s) with the appropriate word(s)