After removing some freshly baked cookies from the oven, you accidentally brush the side of the pan with your bare hand. Your reflexes kick in and you immediately draw your hand away. What is the proximate cause of this behavior?
A. Drawing your hand away quickly when it encounters high heat prevents injury, thereby increasing your chances to survive and reproduce.
B. For millions of years, your ancestors survived in part because they avoided damaging heat, and thus were able to pass on heat-avoiding genes to you.
C. You perceived the heat, judged that it would cause a burn if you left your hand in place too long, and made a conscious decision to pull your hand away.
D. Sensory receptors in the skin of your hand sent a signal to interneurons in your spinal cord, which subsequently signaled the motor neurons in your arm and hand to contract, drawing your hand away.
Answer: D
You might also like to view...
Embryogenesis in plants is about the same process as _____
A) cleavage in animals B) gastrulation in animals C) organogenesis in animals D) cleavage, gastrulation, and organogenesis in animals
Which of the following includes a tandem duplication within the sequence GTCCTTATTCA?
A) GTCCTGATTATTCA B) GTCCACTTATT C) GTCCTTATTCAACTTATTCCTG D) GTCCTTATATTCA
amino acids that cannot be produced by the body are called ___ amino acids
Fill in the blank(s) with the appropriate word(s).
After blood clots, the yellowish fluid that escapes from the clot is called
A. plasma. B. lymph. C. fibrinogen. D. serum. E. thrombin.