Animal cells dismantle and dispose of intracellular waste materials by

a. using centrally located vacuoles.
b. several lysosomes fusing with vesicles that have formed at a cell's plasma membrane.
c. microvilli packaging and exporting the wastes.
d. mitochondrial breakdown of the wastes.
e. activating T cells.


B

Biology & Microbiology

You might also like to view...

When scientists used flaps on the same plant to make observations of water flow they were attempting to remove the possibility of:

A. artificial results B. experimental variation C. differentiated results D. separation factors E. alignment factors

Biology & Microbiology

If carrier testing determines that one parent is a heterozygous carrier of an autosomal recessive genetic defect, while the other parent is not a carrier, then the fetus has a(n) ____________________ % chance of being affected

Fill in the blank(s) with correct word

Biology & Microbiology

Baby frog #1 was born with brown skin instead of the normal green. DNA was collected from the baby frog and the DNA sequence of part of gene B was determined using the primer 5? ACTCAAGCACAGGTCG 3?. What is the entire sequence of the smallest DNA fragment produced in the sequencing reaction? (See diagram for sequencing data.)



A) C
B) 5? ACTCAAGCACAGGTCGC
C) 5? AGGTCGG
D) 5? CATAAATGTCCTGTTATTTGG
E) 5? CGACCTG

Biology & Microbiology

Describe the genetic material of a prokaryote.

A) DNA is arranged in several linear chromosomes. B) A circular piece of DNA is found in the nucleus. C) Prokaryotic chromosomes can be found in their mitochondria. D) Circular pieces of DNA are found in the cytoplasm. E) One long strand of DNA is found in the nucleus.

Biology & Microbiology