Most of the carbon dioxide produced by the body is transported to the lungs
a. as a gas.
b. dissolved in blood plasma.
c. bound to potassium carbonate ions.
d. as bicarbonate ions.
e. as carbonic acid molecules.
D
You might also like to view...
Riboswitches are alternative RNA structures mediated by the binding of molecules to the RNA. One example of a riboswitch is the intrinsic terminator hairpin (stem-loop) structure that may form in specific sites of newly transcribed RNA
This stable RNA hairpin, if followed by 4–8 uridine residues at the 3' end, is a signal for transcriptional termination of that RNA. The termination of transcription involves interactions of the RNA polymerase, the hairpin, and the template strand sequence. RNA polymerase reads the DNA template strand 3' to 5' while synthesizing the new (nascent) RNA strand 5' to 3'. Which of the following DNA sequences, when transcribed, will most likely form an intrinsic transcription termination RNA structure? A. 3' AAAAAAUUUUUU TTTTT 5' B. 3' ACCCCCATGGGGGAAAAAA 5' C. 3' GGGGGGTTTCCCCCTTTTTT 5' D. 3' ACGACCCGGACGGGGGGG 5' E.3' TTTTTTCCCCCCAAAGGGGGG 5'
Enzymes that catalyze the removal of a a functional group and its subsequent attachment to a new substrate are called ________.
A. oxidoreductases B. ligases C. lyases D. transferases E. isomerases
Prokaryotes control their gene expression mainly by ________
a. translational control b. post-translational modification c. adjusting the rate of transcription d. control over mRNA processing
Which of the following statement is not TRUE
A. during aerobic respiration most of the energy is derived from the electron transport system B. complete oxidation of glucose involves the formation of CO2 and H2O C. all of the above are TRUE statements D. fermentation yields less energy than anaerobic respiration E. most of the energy in fermentation is left in the end products