Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide??Normal gene: ATGGCCGGCCCGAAAGAGACCMutated gene: ATGGCCGGCACCGAAAGAGACC?Normal protein: Met-Ala-Gly-Pro-Lys-Glu-ThrMutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
A. base addition-frameshift
B. substitution-nonsense
C. base addition-missense
D. substitution-missense
E. base addition-silent
Answer: A
You might also like to view...
Choose the true statements about the evolution of flower symmetry.
_____ Some radially symmetric flowers have ancestors with bilaterally symmetric flowers. _____ Having radially symmetric flowers is ancestral to having bilaterally symmetric flowers. _____ All cases of flowers with bilateral symmetry involve the CYCLOIDIA (CYC) gene. _____ Bilateral symmetry in some flowers is a homoplastic character derived through convergent evolution.
Which group of fungi has hyphae that are multinucleate and not divided by septa?
a. monokaryotic b. unicellular c. ascomycete d. coenocytic e. sporophyllous
After mutagenesis and screening take place, you have found a mutant that is able to grow in soil with high copper content. Protein analysis shows that the concentration of metallothioneins in the mutant is different from that in normal plants. How does the concentration of metallothioneins likely differ in the mutant relative to the normal plant?
A) Metallothioneins are absent in the mutant. B) The concentration of metallothioneins is lower in the mutant. C) The concentration of metallothioneins is greater in the mutant. D) Metallothioneins are the most abundant proteins in the mutant.
Biological magnification of persistent toxins would be greatest in a
A. deer. B. oak tree. C. black bear. D. fox. E. mushroom.