Victims of CO poisoning turn “classic cherry red” in ____ percent of cases

a. 90
b. 50
c. 20
d. 2
e. 0


ANSWER: d

Biology & Microbiology

You might also like to view...

Identifying carboxysomes in a bacterium suggests it

A) contains the reverse citric acid cycle. B) has a deficient Calvin cycle and accumulated CO2. C) is in a carboxylic acid rich environment and is storing excess quantities for potentially harsh conditions. D) will use the Calvin cycle convert the concentrated CO2 into biomass.

Biology & Microbiology

Which of the following sequences contain a six-nucleotide inverted repeat?

A. GTCACGCGACGATACGGTCACG B. GTCACGACTAGCCTAGTCGCTG C. GTCACGACTAGCCATCAGCCTG D. GTCACGACTAGCCCGACTAGTG

Biology & Microbiology

Most of the dry weight of a plant is the result of uptake of

a) CO2 through stoma. b) water and minerals through mycorrhizae. c) CO2 and O2 through stomata in leaves. d) carbohydrates in the root hairs and concentration in the root cortex. e) water and minerals through root hairs.

Biology & Microbiology

Which of the following represents what Darwin thought of natural selection?

a. He reasoned that if characteristics that better enable organisms to adapt to specific environmental pressures exist, then selective breeding could do the same. b. He reasoned that if a person could select different characteristics when breeding organisms, then nature could do so as well. c. Humans were selecting the characteristics they wanted in the offspring by choosing parents with those traits. d. Humans were selecting the characteristics they wanted in the offspring by eliminating indiv

Biology & Microbiology