Aquaporins are ____
a. cells that are specialized for water transport
b. transport channels for water
c. the entry point of filtrate into a nephron
d. transport channels for ions
e. the exit channel for urine out of a nephron
ANSWER: b
You might also like to view...
The ends of chromosomes are called ________.
A. telomeres B. centromeres C. caps D. DNA termini
Riboswitches are alternative RNA structures mediated by the binding of molecules to the RNA. One example of a riboswitch is the intrinsic terminator hairpin (stem-loop) structure that may form in specific sites of newly transcribed RNA
This stable RNA hairpin, if followed by 4–8 uridine residues at the 3' end, is a signal for transcriptional termination of that RNA. The termination of transcription involves interactions of the RNA polymerase, the hairpin, and the template strand sequence. RNA polymerase reads the DNA template strand 3' to 5' while synthesizing the new (nascent) RNA strand 5' to 3'. Which of the following DNA sequences, when transcribed, will most likely form an intrinsic transcription termination RNA structure? A. 3' AAAAAAUUUUUU TTTTT 5' B. 3' ACCCCCATGGGGGAAAAAA 5' C. 3' GGGGGGTTTCCCCCTTTTTT 5' D. 3' ACGACCCGGACGGGGGGG 5' E.3' TTTTTTCCCCCCAAAGGGGGG 5'
When culturing for Mycobacterium, rapid-growers usually produce colonies within how many days after subculture?
a. At least 7 days b. Longer than 7 days c. 3 to 4 days d. 2 to 3 days
In an attempt to visualize the fluid mosaic model of a
membrane, we could describe the __________ as floating in a sea of __________. a. lipid; protein. b. phospholipids; carbohydrate. c. proteins; lipid. d. fats; water. e. glycolipids; sterols.