Liquid water has surface tension and a high specific heat, and it functions effectively as a solvent for polar covalent and ionically bonded molecules. What feature of water imparts these properties?
A) The hydrogen and oxygen that make up water form nonpolar covalent bonds.
B) It readily dissociates to form H+and OH- ions.
C) It has a high molecular weight.
D) Water readily forms hydrogen bonds with other water molecules, and with polar solutes.
D) Water readily forms hydrogen bonds with other water molecules, and with polar solutes.
You might also like to view...
Riboswitches are alternative RNA structures mediated by the binding of molecules to the RNA. One example of a riboswitch is the intrinsic terminator hairpin (stem-loop) structure that may form in specific sites of newly transcribed RNA
This stable RNA hairpin, if followed by 4–8 uridine residues at the 3' end, is a signal for transcriptional termination of that RNA. The termination of transcription involves interactions of the RNA polymerase, the hairpin, and the template strand sequence. RNA polymerase reads the DNA template strand 3' to 5' while synthesizing the new (nascent) RNA strand 5' to 3'. Which of the following DNA sequences, when transcribed, will most likely form an intrinsic transcription termination RNA structure? A. 3' AAAAAAUUUUUU TTTTT 5' B. 3' ACCCCCATGGGGGAAAAAA 5' C. 3' GGGGGGTTTCCCCCTTTTTT 5' D. 3' ACGACCCGGACGGGGGGG 5' E.3' TTTTTTCCCCCCAAAGGGGGG 5'
The membrane-attack complex is a group of proteins that supplements the inflammatory response
a. True b. False Indicate whether the statement is true or false
In many mammalian species, including bats and most non-human primates, a bone in the penis, called
the ____, helps to maintain it in an erect state.
a. pendulum b. baculum c. colostrum d. gametogonium e. marsupium
The major categories of hypersensitivities that typically involve a B-cell immunoglobulin response is/are
A. Type 1 only. B. Type 4 only. C. Type 1, Type 2, Type 3. D. Type 1 and Type 4. E. Type 1, Type 2, Type 3, and Type 4.