Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?

Normal gene: ATGGCCGGCCCGAAAGAGACC
Mutated gene: ATGGCCGGCACCGAAAGAGACC
Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

A. base addition - silent
B. substitution - missense
C. base addition - missense
D. substitution - nonsense
E. base addition-frameshift


E. base addition-frameshift

Biology & Microbiology

You might also like to view...

Answer the following statements true (T) or false (F)

1. The penicillin molecule is an example of a hapten. 2. Autoimmune diseases are always the result of type II hypersensitivity reactions. 3. With respect to a particular pathogen, detection of antibodies in a patient's blood provides better proof of current infection than does detection of antigens. 4. If a person's immune system is not functioning properly, that person is said to be immunocompetent. 5. An IgM molecule can bind to 10 antigenic determinants, but they would all have to be the antigenic determinant that stimulated the production of that IgM molecule.

Biology & Microbiology

In every physical or chemical change, the universe tends toward greater disorder. This is the ________ law of thermodynamics, or the law of thermodynamic ________.

Fill in the blank(s) with the appropriate word(s).

Biology & Microbiology

Structural isomers differ from each other ____

a. in the arrangement of their covalent bonds b. in their molecular formulas c. by being mirror images that cannot be superimposed on each other d. by having double covalent bonds instead of single bonds e. by having different atomic isotopes in their molecules

Biology & Microbiology

As an individual grow fatter, further weight gain is minimized by diet-inducing _________.

Fill in the blank(s) with the appropriate word(s).

Biology & Microbiology