In order to transfer gene a to an F- cell, the sex pilus must be in place for at least ____ minutes
a. 0
b. 6
c. 10
d. 14
e. 25
ANSWER: b
You might also like to view...
Riboswitches are alternative RNA structures mediated by the binding of molecules to the RNA. One example of a riboswitch is the intrinsic terminator hairpin (stem-loop) structure that may form in specific sites of newly transcribed RNA
This stable RNA hairpin, if followed by 4–8 uridine residues at the 3' end, is a signal for transcriptional termination of that RNA. The termination of transcription involves interactions of the RNA polymerase, the hairpin, and the template strand sequence. RNA polymerase reads the DNA template strand 3' to 5' while synthesizing the new (nascent) RNA strand 5' to 3'. Which of the following DNA sequences, when transcribed, will most likely form an intrinsic transcription termination RNA structure? A. 3' AAAAAAUUUUUU TTTTT 5' B. 3' ACCCCCATGGGGGAAAAAA 5' C. 3' GGGGGGTTTCCCCCTTTTTT 5' D. 3' ACGACCCGGACGGGGGGG 5' E.3' TTTTTTCCCCCCAAAGGGGGG 5'
The first O2 producing organisms were probably
a. cyanobacteria. b. Archaea. c. green algae. d. red algae. e. plants.
As more is learned about cancer, it has become clear that cancer, with few exceptions, has no genetic basis
Indicate whether the statement is true or false
Select the pair in which the nitrogenous waste is INCORRECTLY matched with the benefit of its excretion.
A. urea: very insoluble in water B. urea: low toxicity relative to ammonia C. uric acid: minimal loss of water when excreted D. ammonia: very soluble in water E. uric acid: can be stored and excreted as a precipitate