Which one of the following sequences is most likely to form a hairpin with a 5 nucleotide loop?

A. TTTTAGACTGAAATAGTCTTTTT
B. TACGAAATACGGGATTTA
C. AAAAAAAATTTTTTT
D. CCCGGGAAAAAAAAACCCGGG
E. ACATACAGACCCAATTGACATAG


A

Biology & Microbiology

You might also like to view...

Describe the various structures on the aboral “spiny skin” of a sea star and discuss their functions.

What will be an ideal response?

Biology & Microbiology

Each of the following transfers DNA into bacteria except

A) conjugation. B) infection. C) transduction. D) transformation. E) All transfer DNA into bacteria.

Biology & Microbiology

Which of the following is the most likely result at the completion of the project?

(A) The biomass of coyotes will be 6 kg, and the biomass of hawks will be 0.5 kg. (B) The biomass of coyotes will be dramatically reduced. (C) The coyotes will switch prey preferences and outcompete the hawks. (D) There will be 50 percent fewer voles and 90 percent fewer hawks.

Biology & Microbiology

Which statement most accurately describes the evolutionary relationships among the three domains?

A. Bacteria and Eukarya diverged from a common ancestor more recently than they diverged from their common ancestor with Archaea. B. Bacteria and Archaea diverged from a common ancestor more recently than they diverged from their common ancestor with Eukarya. C. All three domains diverged from a common ancestor at the same time. D. Eukarya and Archaea diverged from a common ancestor more recently than they diverged from their common ancestor with Bacteria.

Biology & Microbiology