Bacterial smears are fixed before staining to
A) affix the cells to the slide.
B) make their walls permeable.
C) accept stain.
D) make the cells visible.
A
You might also like to view...
Which of the following sequences contain a six-nucleotide inverted repeat?
A. GTCACGCGACGATACGGTCACG B. GTCACGACTAGCCTAGTCGCTG C. GTCACGACTAGCCATCAGCCTG D. GTCACGACTAGCCCGACTAGTG
Comparison of gene sequences among species has revealed:
A) the greater the similarities in gene sequences, the more recently two species shared a common ancestor. B) the greater the differences in gene sequences, the more recently two species shared a common ancestor. C) humans and snakes are more closely related than humans and pigs. D) humans and yeast shared a recent common ancestor.
Turtles are members of the ____ reptilian lineage
a. Testudines b. Archosauria c. Squamata d. Sphenodontida e. Amphibia
In a monohybrid cross with complete dominance, the F2 offspring should contain _____
A. two different phenotypes and two different genotypes B. two different phenotypes and three different genotypes C. three different phenotypes and two different genotypes D. three different phenotypes and three different genotypes E. none of these