How many amino acids would be included in the polypeptide encoded by the following mRNA:
5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'
A. 7
B. 8
C. 10
D. 13
B
You might also like to view...
Critical thinking means to ____
a. challenge all concepts b. evaluate information before accepting it c. disagree with proposed ideas d. make quick decisions e. base decisions on opinions
How can you test the following statement using the scientific methodology? "Exam performance improves as the amount of sleep obtained the night before an exam increases."
What will be an ideal response?
After meiosis I, ________ cells are formed, and after meiosis II, ________ cells result.
A. 2, 3 B. 2, 8 C. 4, 8 D. 4, 4 E. 2, 4
The difference between a drupe and a berry is that a drupe:a
is an accessory fruit, while a berry is a multiple fruit. b. is formed from a single carpel, while a berry is formed from many carpels. c. has a stony pit around a single seed, while a berry is fleshy throughout with many seeds. d. is a dry fruit, while a berry is a fleshy one. e. splits open along two sutures, while a berry splits open along one suture.