Which are the first three amino acids encoded by the wild-type sequence of gene B?
In frogs, green skin is determined by gene B. The wild-type sequence of the 5? end of the RNA-like strand of the entire first exon is shown below. The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin.
5? ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3?
The table of codons is provided here:
A) N-Thr-Gln-Ala…
B) N-Pro-Asn-Asn…
C) N-Met-Phe-Leu…
D) N-Ser-Ser-Val…
E) The correct sequence is not shown here.
C) N-Met-Phe-Leu…
You might also like to view...
During radioactive decay, the nucleus of an atom ________
a. disintegrates, releasing particles and energy b. captures an unclaimed proton c. transposes its neutrons and electrons d. converts from a relatively stable to an unstable form
Antimicrobial agents can target the cell wall by
A. digesting it. B. blocking its synthesis. C. denaturing proteins. D. All of the choices are correct.
Cilia and microvilli contain a similar number of parallel actin filaments
a. true b. false
Following damage, what is the correct order of events during excision repair?
a. synthesis, incision, excision, ligation b. incision, excision, synthesis, ligation c. incision, synthesis, ligation, excision d. ligation, synthesis, excision, incision e. excision, incision, synthesis, ligation