Shown below is a hypothetical DNA sequence from a virus. Also shown is the sequence of the mRNA that is synthesized from this DNA.DNA sequence:5'-AGCACCTGCCGAATGGGCCAAATCCTGCCGAATAAA-3'3'-TCGTGGACGGCTTACCCGGTTTAGGACGGCTTATTT -5'mRNA sequence (G* = G cap):5'-G*AGCACCUGCCGCCUGCCGAAUAAAAAAA....-3' How many introns does this DNA segment contain? (Enter your answer as a numeral, not a word; e.g., enter 5, not five.)

Question

Fill in the blank(s) with the appropriate word(s).

Answer 1

1

Clarify Question
• What is the key concept addressed by the question?
        o The question asks about the sequence of an intron.
• What type of thinking is required?
        o You are being asked to analyze the sequence of an intron based on a mRNA.

Gather Content
• What do you know about introns? What other information is related to the question?
        o An intron sequence will not appear in the final mRNA after it was spliced out. The template sequence will be the reverse complement sequence of the intron.

Choose Answer
• Given what you now know, what information is most likely to produce the correct answer?
        o For the DNA sequence:
5'-AGCACCTGCCGAATGGGCCAAATCCTGCCGAATAAA-3'
3'-TCGTGGACGGCTTACCCGGTTTAGGACGGCTTATTT -5'.
        o And the mRNA sequence
5' AGCACCUGCCGCCUGCCGAAUAAAAAAA 3'
        o The intron will be the sequence that is in the mRNA and not the DNA
5' AATGGGCCAAAT 3'
        o So there is only one intron

Reflect on Process
• Did your problem-solving process lead you to the correct answer? If not, where did the process break down or lead you astray? How can you revise your approach to produce a more desirable result? 
        o This question asked you to analyze the sequence of an intron based on a mRNA. If you got the correct answer, great job! If you got an incorrect answer, where did the process break down? Did you recall that introns are spliced out of a mRNA? Did you understand that the intron sequence would be in the DNA and not mRNA?