During a 5-mile run in the high Alps, where oxygen concentration is lower, your body will produce less ATP per molecule of glucose than after the same run near sea level, where there is plenty of oxygen to supply your muscle cells

Approximately how many more molecules of ATP will your muscle cells produce per molecule of glucose at the lower elevation than at the oxygen-scarce high elevation? A) 36
B) 34
C) 32
D) 2


B

Biology & Microbiology

You might also like to view...

Transformation involves contact between two bacterial cells, followed by the unidirectional transfer of plasmid genes

Indicate whether the statement is true or false.

Biology & Microbiology

Which of the following includes a tandem duplication within the sequence GTCCTTATTCA?

A) GTCCTGATTATTCA B) GTCCACTTATT C) GTCCTTATTCAACTTATTCCTG D) GTCCTTATATTCA

Biology & Microbiology

According to Mendel, what kinds of genes

"disappear" in F1 pea plants? a. sex-linked b. dominant c. recessive d. codominant e. lethal

Biology & Microbiology

Which of the following mechanisms removes nucleotides that are paired incorrectly during DNA replication?

A. mismatch repair B. chromosomal breakage repair C. telomerase activity D. nucleotide excision repair

Biology & Microbiology