The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below
AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG
How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
A) two
B) three
C) four
D) five
Answer: C
You might also like to view...
Comparatively greater energy is released when
A. carbon dioxide is the final electron acceptor. B. hydrogen is the final electron acceptor. C. nitrate is the final electron acceptor. D. oxygen is the final electron acceptor.
A doctor discovers that her patient can produce antibodies against some bacterial pathogens, but he is unable to protect himself against viral infections. The doctor suspects a disorder in her patient's
A. B cells. B. plasma cells. C. cytotoxic T cells. D. suppressor T cells. E. macrophages.
If individuals move from one population to another, it may cause a shift in allele frequencies due to
a. genetic drift. b. directional selection. c. natural selection. d. mutation. e. gene flow.
The developing embryo in Figure 51-2 is representative of development in:
a. a bird. b. an annelid. c. a sea star. d. a frog. e. a mammal