Mature plants may become __________ in dry or cold seasons in order to survive long periods that are unfavorable for growth.
A. dormant
B. dehydrated
C. photoperiodic
D. thigmonastic
E. gravitropic
A. dormant
You might also like to view...
The study of the crown gall tumor found
A. a bacterial plasmid promoter that was similar to plant promoters. B. an R plasmid. C. incorporation of the bacterial chromosome into the plant. D. incorporation of the plant chromosome into the bacteria.
Which of the following includes a tandem duplication within the sequence GTCCTTATTCA?
A) GTCCTGATTATTCA B) GTCCACTTATT C) GTCCTTATTCAACTTATTCCTG D) GTCCTTATATTCA
Primary active transport results in which of the following?
a. A charge difference across a membrane b. A pocket forming around target particles c. The formation of additional ATP d. The reduction in extracellular fluid
Which of the following statements is NOT true about the flatworms?
a) Liver flukes and blood flukes are parasites in humans only. b) Schistosomiasis is a common human blood disease caused by flukes in tropical areas. c) Tapeworms are hermaphroditic, having both male and female reproductive structures in each proglottid. d) Planaria contain pigmented, photosensitive eyespots. e) tapeworms have a ladder-type nervous system similar to other flatworms.