Referring to the image above, what is the amino acid sequence that is coded for by the DNA sequence
GATGGACTTGAAGAGTGGTAA?
a. asp-gly-val-glu-glu-trp-tyr
b. leu-pro-glu-leu-leu-thr-ile
c. ile-thr-leu-leu-gly-pro-leu
d. ser-arg-arg-met-gly-val-stop
e. met-gly-val-lys-ser-gly-stop
ANSWER: b
You might also like to view...
Which statement regarding porphyrin synthesis pathways is CORRECT?
A. The succinyl-CoA/glycine porphyrin pathway is used by all bacteria, photosynthetic eukaryotes, and archaea. B. The porphyrin biosynthetic pathways are unified at the step of 5-aminolevulinic acid. C. The glutamate porphyrin pathway is used by all non-photosynthetic eukaryotes and alpha-proteobacteria. D. There is very little conservation of porphyrin synthesis pathways between eukaryotes, bacteria, and archaea.
A core sample is taken 100 km west of and parallel to a ridge system. Magnetic readings of the rock show a reversal of the Earth's magnetic field. How many km east of the ridge system must scientists travel to collect a core sample with the same magnetic properties?
a. 50 b. 100 c. 200 d. 0 km; collect the sample directly at the ridge
In meiosis, chromosomes containing sister chromatids (not homologous chromosomes) align along the center of the cell during
A. metaphase II. B. prophase II. C. prophase I. D. interphase II. E. metaphase I.
Which of the following is TRUE of fertilization?
A. It is critical to maintaining membrane polarity. B. It restores the egg to a diploid state. C. It both restores the egg to a diploid state and maintains membrane polarity. D. It activates cell division. E. It both restores the egg to a diploid state and activates cell division.