The DNA sequence encoding the leader peptide of the trp operon was mutated as shown below. The wild-type and altered nucleotide is bolded for ease of identification
ATGAAAGCAATTTCCGTACTGAAAGGTTGGTGGCGCACTTCCTGA wild type leader peptide
coding sequence
ATGAAAGCAATTTCCGTACTGAAAGGTGGGTGGCGCACTTCCTGA mutant leader peptide
coding sequence
What change in the control of trp operon expression is most likely to occur in E. coli cells containing the mutant leader peptide coding sequence compared to wild type?
A. The Trp repressor will bind more tightly to the trp operon in the mutant cells.
B. The amount of attenuation will be reduced in the mutant.
C. Negative control of the trp operon will be increased in the mutant.
D. Open promoter complexes will form less often in the mutant.
B
You might also like to view...
The definitive identification of which of the following organisms is accomplished by hemad-sorption techniques?
a. Chlamydia trachomatis b. Mycoplasma hominis c. Mycoplasma pneumoniae d. Mycoplasma genitalium
Sites of transcription and therefore most of the genes along the length of the chromosome appear to be found in
A) heterochromatin. B) euchromatin. C) constitutive heterochromatin. D) centromeric regions.
The plant photoreceptor phytochrome is important for which of the following?
a. photomorphogenesis b. photorespiration c. growth d. photosynthesis
All of the following are found in some or all protozoa except
A. cell wall. B. ectoplasm and endoplasm. C. heterotrophic nutrition. D. formation of a cyst stage. E. motility.