A group that comprises an ancestor in which a derived trait evolved and all of its descendants is called:
a. a cladogram.
b. a clade.
c. a monophyletic group.
d. a sister group.
e. a polyphyletic group.
c
You might also like to view...
Riboswitches are alternative RNA structures mediated by the binding of molecules to the RNA. One example of a riboswitch is the intrinsic terminator hairpin (stem-loop) structure that may form in specific sites of newly transcribed RNA
This stable RNA hairpin, if followed by 4–8 uridine residues at the 3' end, is a signal for transcriptional termination of that RNA. The termination of transcription involves interactions of the RNA polymerase, the hairpin, and the template strand sequence. RNA polymerase reads the DNA template strand 3' to 5' while synthesizing the new (nascent) RNA strand 5' to 3'. Which of the following DNA sequences, when transcribed, will most likely form an intrinsic transcription termination RNA structure? A. 3' AAAAAAUUUUUU TTTTT 5' B. 3' ACCCCCATGGGGGAAAAAA 5' C. 3' GGGGGGTTTCCCCCTTTTTT 5' D. 3' ACGACCCGGACGGGGGGG 5' E.3' TTTTTTCCCCCCAAAGGGGGG 5'
Joints help do what?
What will be an ideal response?
Collagen is a tough, stretch-resistant protein. You would be most likely to find collagen in which tissue type?
A. Nervous B. Connective C. Epithelial D. Muscle E. Epithelial and connective tissue
The house plant Kalanchoë daigremontiana produces ________ to reproduce asexually.
A. runners B. suckers C. rhizomes D. adventitious plantlets