________ fatty acids are liquid at room temperature, while ________ fatty acids are solid.

Fill in the blank(s) with the appropriate word(s).


Unsaturated; saturated

Biology & Microbiology

You might also like to view...

Sedimentation in bogs and marshes develop ________ soils

A) inorganic B) mineral C) organic D) loamy

Biology & Microbiology

Describe the difference between the use of streptokinase and coagulase as a defense mechanism among pathogens

What will be an ideal response?

Biology & Microbiology

Riboswitches are alternative RNA structures mediated by the binding of molecules to the RNA. One example of a riboswitch is the intrinsic terminator hairpin (stem-loop) structure that may form in specific sites of newly transcribed RNA

This stable RNA hairpin, if followed by 4–8 uridine residues at the 3' end, is a signal for transcriptional termination of that RNA. The termination of transcription involves interactions of the RNA polymerase, the hairpin, and the template strand sequence. RNA polymerase reads the DNA template strand 3' to 5' while synthesizing the new (nascent) RNA strand 5' to 3'. Which of the following DNA sequences, when transcribed, will most likely form an intrinsic transcription termination RNA structure? A. 3' AAAAAAUUUUUU TTTTT 5' B. 3' ACCCCCATGGGGGAAAAAA 5' C. 3' GGGGGGTTTCCCCCTTTTTT 5' D. 3' ACGACCCGGACGGGGGGG 5' E.3' TTTTTTCCCCCCAAAGGGGGG 5'

Biology & Microbiology

The conversion of pyruvic acid to acetyl-CoA can be described as ________, because a molecule of CO2 is produced as a by-product

A) decarboxylation B) amination C) respiration D) oxidation E) phosphorylation

Biology & Microbiology