Which of the following fragments would be generated when the following sequence is cut by SmaI?
5? TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3?
A. One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment
B. One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment
C. Two 19 bp fragments
D. One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment
B
You might also like to view...
When forcing overhead doors, which of the following is BEST to use?
A. Rotary saw B. Prying tool C. Cutting torch D. Pick-head axe
Which of the following statements is true about the lectin pathway?
a. Involves a recognition unit and an activation phase b. Is activated in an antibody-independent fashion c. Is usually triggered by an immunoglobulin-antigen complex d. Primarily responds to charged and neutral sugars
As a provision of the Accountable Care Act, health care insurers were encouraged to unite with health care providers to form what type of an organization?
A. health maintenance organization B. preferred provider organization C. open access plan D. accountable care organization E. indemnity plan
On the ECG graph paper, 6 seconds is represented by how many large boxes?
A) 20 B) 30 C) 40 D) 50