Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred?
Normal gene: ATGGCCGGCCCGAAAGAGACC
Mutated gene: ATGGCCGGCACCGAAAGAGACC
Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr
Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp
A. base addition-silent
B. base addition-none
C. base addition-missense
D. base addition-nonsense
E. base addition-frameshift
C. base addition-missense
You might also like to view...
What is the function of pain?
a. It causes an organism to move away from, or otherwise decrease exposure to, a damaging stimulus. b. It stimulates the brain to release endorphins to prevent an addiction. c. It protects an organism from encountering harmful conditions. d. It works faster than conscious thought. e. It causes an organsim’s heart rate to increase to deliver more blood to a damaged body part.
Fruit flies, mollusks, and humans have insulin-like hormones and receptors, even though molecular
studies suggest that their last common ancestor existed more than 800 million years ago.
Indicate whether the statement is true or false.Which of these terms is NOT used as a nickname for a stop codon?
A) emerald B) amber C) opal D) ochre
Protection Mechanism I: temporal
What will be an ideal response?