Describe at least 3 physical factors that limit coral reef distribution

What will be an ideal response?


The reef building corals require a minimum average annual temperature above 18? C. Because of their symbiotic relationship with zooxanthellae they must remain in well lighted surface waters, generally 25 meters or less. They cannot tolerate low salinities, and thus avoid areas near river mouths. Sediment clogs corals and reduces light, preventing their presence in turbid waters. Lowest tides define their upward growth as air and UV exposure can kill the corals.

Biology & Microbiology

You might also like to view...

How many amino acids would be included in the polypeptide encoded by the following mRNA:

5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3' A. 7 B. 8 C. 10 D. 13

Biology & Microbiology

When grouping organisms, which classification is most general for a particular type of organism?

A. Kingdom B. Phylum C. Order D. Family E. Species

Biology & Microbiology

The major disadvantage of using stem cells derived from human embryos was:

a. they did not differentiate. b. they were difficult to maintain in culture. c. they did not function in humans other than those that they were obtained from. d. they could not be frozen. e. they did not contain fully active telomerase.

Biology & Microbiology

How does a four chambered heart allow for different blood pressure to exist in the pulmonary and systemic circuits? Why is this important?

What will be an ideal response?

Biology & Microbiology