In the process of transcription, _____
A) DNA is replicated
B) RNA is synthesized
C) proteins are synthesized
D) mRNA attaches to ribosomes
B
You might also like to view...
Summarize the sequence of processing, sorting, and transport of proteins synthesized in a human cell. Then indicate which cell component corresponds with each number above
What will be an ideal response?
The BRCA2 protein functions in double-strand break repair. If a woman is heterozygous for a loss-of-function allele of BRCA2, she
A) will develop cancer because two functional copies of BRCA2 are needed in every cell. B) will not get cancer because BRCA1 can compensate for the loss of BRCA2. C) will develop cancer after several mutations occur, even if the mutations occur in different clonal populations of cells. D) may develop cancer because mutation of the wild-type BRCA2 allele could destroy an important DNA repair mechanism.
Fungi and Plantae kingdoms are similar in that both
A. contain autotrophic organisms. B. contain cell walls. C. reproduce by seed. D. have roots and leaves.
You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Select the primers that should be used.5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'
A. 5' - AGGGC- 3' and 5' -GATTG- 3'. B. 5' -GTTAG -3' and 5' -ATCCC -3'. C. 3' -CAATC- 5' and 3' -GCCCT- 5'. D. 5' -CAATC- 3' and 5' -GCCCT- 3'. E. 3' - AGGGC- 5' and 3' -GATTG- 5'.