A prokaryotic cell has all of the following EXCEPT ____

a. a plasma membrane
b. DNA
c. cytoplasm
d. a nucleus inside a membrane
e. ribosomes


ANSWER: d

Biology & Microbiology

You might also like to view...

As the difference in reduction potential between a redox pair increases, the amount of free energy made available ________.

A. decreases B. remains the same C. increases D. cannot be determined

Biology & Microbiology

A variation of the PGD method, called ____________________, can test for genetic disorders in the egg before fertilization

Fill in the blank(s) with correct word

Biology & Microbiology

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?

Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A. base addition - silent B. substitution - missense C. base addition - missense D. substitution - nonsense E. base addition-frameshift

Biology & Microbiology

The chewy, stringy cells in celery are which cells?

a. xylem b. collenchyma c. phloem d. sclerenchyma e. parenchyma

Biology & Microbiology