A prokaryotic cell has all of the following EXCEPT ____
a. a plasma membrane
b. DNA
c. cytoplasm
d. a nucleus inside a membrane
e. ribosomes
ANSWER: d
You might also like to view...
As the difference in reduction potential between a redox pair increases, the amount of free energy made available ________.
A. decreases B. remains the same C. increases D. cannot be determined
A variation of the PGD method, called ____________________, can test for genetic disorders in the egg before fertilization
Fill in the blank(s) with correct word
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?
Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A. base addition - silent B. substitution - missense C. base addition - missense D. substitution - nonsense E. base addition-frameshift
The chewy, stringy cells in celery are which cells?
a. xylem b. collenchyma c. phloem d. sclerenchyma e. parenchyma