The cell-mediated immunity that destroys virally infected cells primarily involves _____

A) cytotoxic T cells
B) inflammation
C) phagocytosis
D) macrophages
E) B cells


Answer: A

Biology & Microbiology

You might also like to view...

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?

Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A. base addition - silent B. substitution - missense C. base addition - missense D. substitution - nonsense E. base addition-frameshift

Biology & Microbiology

Chlamydia trachomatis produces a dormant, resistant stage which is transmitted from one host to another.

Answer the following statement true (T) or false (F)

Biology & Microbiology

Free-living flatworms (planaria) move by using

(a) cilia. (b) flagella. (c) pseudopodia. (d) a muscular foot.

Biology & Microbiology

Species of Shigella are characteristically non-motile. Based on this information you ca predict that members of the Shigella genus

What will be an ideal response?

Biology & Microbiology