The cell-mediated immunity that destroys virally infected cells primarily involves _____

A) cytotoxic T cells
B) inflammation
C) phagocytosis
D) macrophages
E) B cells


Answer: A

Biology & Microbiology

You might also like to view...

Free-living flatworms (planaria) move by using

(a) cilia. (b) flagella. (c) pseudopodia. (d) a muscular foot.

Biology & Microbiology

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?

Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A. base addition - silent B. substitution - missense C. base addition - missense D. substitution - nonsense E. base addition-frameshift

Biology & Microbiology

Species of Shigella are characteristically non-motile. Based on this information you ca predict that members of the Shigella genus

What will be an ideal response?

Biology & Microbiology

Chlamydia trachomatis produces a dormant, resistant stage which is transmitted from one host to another.

Answer the following statement true (T) or false (F)

Biology & Microbiology