The cell-mediated immunity that destroys virally infected cells primarily involves _____
A) cytotoxic T cells
B) inflammation
C) phagocytosis
D) macrophages
E) B cells
Answer: A
You might also like to view...
Free-living flatworms (planaria) move by using
(a) cilia. (b) flagella. (c) pseudopodia. (d) a muscular foot.
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide?
Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A. base addition - silent B. substitution - missense C. base addition - missense D. substitution - nonsense E. base addition-frameshift
Species of Shigella are characteristically non-motile. Based on this information you ca predict that members of the Shigella genus
What will be an ideal response?
Chlamydia trachomatis produces a dormant, resistant stage which is transmitted from one host to another.
Answer the following statement true (T) or false (F)