If chemical signals in the cytoplasm control the progression of a cell to the M phase of the cell cycle, then fusion of a cell in G1 with a cell in early M phase would most likely result in the

(A) replication of chromosomes only in the G1 cell
(B) exiting of both cells from the cell cycle and into the G0 phase
(C) condensation of chromatin in preparation of nuclear division in both cells
(D) transfer of organelles from the G1 cell to the cell in the M phase


Ans: (C) condensation of chromatin in preparation of nuclear division in both cells

Biology & Microbiology

You might also like to view...

The DNA sequence encoding the leader peptide of the trp operon was mutated as shown below. The wild-type and altered nucleotide is bolded for ease of identification

ATGAAAGCAATTTCCGTACTGAAAGGTTGGTGGCGCACTTCCTGA wild type leader peptide coding sequence ATGAAAGCAATTTCCGTACTGAAAGGTGGGTGGCGCACTTCCTGA mutant leader peptide coding sequence What change in the control of trp operon expression is most likely to occur in E. coli cells containing the mutant leader peptide coding sequence compared to wild type? A. The Trp repressor will bind more tightly to the trp operon in the mutant cells. B. The amount of attenuation will be reduced in the mutant. C. Negative control of the trp operon will be increased in the mutant. D. Open promoter complexes will form less often in the mutant.

Biology & Microbiology

Which of the following statements characterize heterospory?

_____ It involves production of two different types of spores from a single sporangium. _____ It involves production of two different kinds of spores, one growing into male gametophytes and the other into female gametophytes. _____ It increases the chance of cross-fertilization. _____ It increases the potential for genetic variation and aids evolutionary flexibility. _____ It occurs in seed plants and seedless vascular plants.

Biology & Microbiology

Two-thirds of the plasma proteins are

a. chitin. b. keratin. c. elastin. d. albumin. e. glycoproteins.

Biology & Microbiology

The sequencing of the human genome lead to the realization that chromosome 19 contains many genes while chromosomes 13 and Y contain relatively few. This finding implies what about the density of genes in a genome?

A) Genes are not uniformly distributed and appear in clusters separated by large noncoding regions. B) Genes are uniformly distributed throughout the genome. C) Genes are uniformly distributed on chromosomes but not through the entire genome. D) Genes have no organization and randomly appear throughout the genome and chromosomes.

Biology & Microbiology