The notochord persists into adulthood in all chordates
Indicate whether the statement is true or false
FALSE
You might also like to view...
A drug binds to the active site of an enzyme. If it is bound to the active site of the enzyme, it prevents substrate binding. This drug would be considered a
A. noncompetitive inhibitor. B. allosteric inhibitor. C. allosteric activator. D. competitive inhibitor.
Members of the Ecdysozoa (select all that apply)
A. secrete a cuticle made of protein. B. secrete a cuticle made of calcium carbonate. C. molt during growth. D. have trochophore larvae. E. have lophophores.
You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Select the primers that should be used.
5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5' A. 5' - AGGGC- 3' and 5' -GATTG- 3'. B. 5' -CAATC- 3' and 5' -GCCCT- 3'. C. 3' -CAATC- 5' and 3' -GCCCT- 5'. D. 3' - AGGGC- 5' and 3' -GATTG- 5'. E. 5' -GTTAG -3' and 5' -ATCCC -3'.
________ is a hormone produced by the seminiferous tubules that inhibits FSH from stimulating the production of sperm cells
Fill in the blank(s) with correct word