The notochord persists into adulthood in all chordates

Indicate whether the statement is true or false


FALSE

Biology & Microbiology

You might also like to view...

A drug binds to the active site of an enzyme. If it is bound to the active site of the enzyme, it prevents substrate binding. This drug would be considered a

A. noncompetitive inhibitor. B. allosteric inhibitor. C. allosteric activator. D. competitive inhibitor.

Biology & Microbiology

Members of the Ecdysozoa (select all that apply)

A. secrete a cuticle made of protein. B. secrete a cuticle made of calcium carbonate. C. molt during growth. D. have trochophore larvae. E. have lophophores.

Biology & Microbiology

You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Select the primers that should be used.

5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5' A. 5' - AGGGC- 3' and 5' -GATTG- 3'. B. 5' -CAATC- 3' and 5' -GCCCT- 3'. C. 3' -CAATC- 5' and 3' -GCCCT- 5'. D. 3' - AGGGC- 5' and 3' -GATTG- 5'. E. 5' -GTTAG -3' and 5' -ATCCC -3'.

Biology & Microbiology

________ is a hormone produced by the seminiferous tubules that inhibits FSH from stimulating the production of sperm cells

Fill in the blank(s) with correct word

Biology & Microbiology