What was the approximate size of the human population in the year 2008?
A) 1.6 billion
B) 2.6 billion
C) 3.6 billion
D) 6.6 billion
E) 10 billion
Ans: D) 6.6 billion
You might also like to view...
What enzyme is required to produce ATP during oxidative phosphorylation?
a. glucase b. ATP synthase c. acetylcholinesterase d. pepsin
Which are the first three amino acids encoded by the wild-type sequence of gene B?
In frogs, green skin is determined by gene B. The wild-type sequence of the 5? end of the RNA-like strand of the entire first exon is shown below. The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin.
5? ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3?
The table of codons is provided here:
A) N-Thr-Gln-Ala…
B) N-Pro-Asn-Asn…
C) N-Met-Phe-Leu…
D) N-Ser-Ser-Val…
E) The correct sequence is not shown here.
What is carbon fixation?
A. The conversion of dead organisms into fossil fuel. B. The release of carbon dioxide by cellular respiration. C. The conversion of carbon dioxide into organic molecules. D. The storage of carbon compounds by heterotrophs. E. The release of carbon dioxide by combustion.
The ribosomes in chloroplasts are ________, and in cytoplasm they are ________
a. 70S / 70S b. 70S / 80S c. 80S / 70S d. 80S / 80S