What was the approximate size of the human population in the year 2008?

A) 1.6 billion
B) 2.6 billion
C) 3.6 billion
D) 6.6 billion
E) 10 billion


Ans: D) 6.6 billion

Biology & Microbiology

You might also like to view...

What enzyme is required to produce ATP during oxidative phosphorylation?

a. glucase b. ATP synthase c. acetylcholinesterase d. pepsin

Biology & Microbiology

Which are the first three amino acids encoded by the wild-type sequence of gene B?

In frogs, green skin is determined by gene B. The wild-type sequence of the 5? end of the RNA-like strand of the entire first exon is shown below. The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin.

5? ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3?

The table of codons is provided here:


A) N-Thr-Gln-Ala…
B) N-Pro-Asn-Asn…
C) N-Met-Phe-Leu…
D) N-Ser-Ser-Val…
E) The correct sequence is not shown here.

Biology & Microbiology

What is carbon fixation?

A. The conversion of dead organisms into fossil fuel. B. The release of carbon dioxide by cellular respiration. C. The conversion of carbon dioxide into organic molecules. D. The storage of carbon compounds by heterotrophs. E. The release of carbon dioxide by combustion.

Biology & Microbiology

The ribosomes in chloroplasts are ________, and in cytoplasm they are ________

a. 70S / 70S b. 70S / 80S c. 80S / 70S d. 80S / 80S

Biology & Microbiology