When the ________ muscle of the leg contracts, the lower leg is moved closer to the thigh.
Fill in the blank(s) with the appropriate word(s).
flexor
When the flexor muscle of the leg contracts, the lower leg is moved closer to the thigh.
You might also like to view...
Which of the following statements about muscle contraction is false?
A. Actin and myosin filaments shorten during muscle contraction. B. Sarcomere length is variable in invertebrates, but uniform in vertebrates. C. Longer sarcomeres allow for a greater degree of shortening. D. Actin and myosin filaments overlap more when a muscle is contracted than when it is relaxed. E. Rapidly contracting muscles express myosin molecules that have higher rates of ATP hydrolysis.
Choose the incorrect statement regarding chaperone-assisted protein folding in bacteria
A. The DnaJ/DnaK complex requires ATP to facilitate protein folding. B. DnaJ and DnaK will both bind the unfolded protein. C. A single DnaJ/DnaK complex is rarely sufficient for complete protein folding. D. GrpE stimulates binding of ATP to DnaJ. E. DnaJ prevents aggregation of unfolded polypeptides.
Which one of the following sequences is most likely to form a hairpin with a 5 nucleotide loop?
A. TTTTAGACTGAAATAGTCTTTTT B. TACGAAATACGGGATTTA C. AAAAAAAATTTTTTT D. CCCGGGAAAAAAAAACCCGGG E. ACATACAGACCCAATTGACATAG
A circadian rhythm has a period that approximates a(n) 12-hour cycle. Indicate whether the statement is true or false