A molecular biologist is interested in purifying a recombinant protein by His-tagging, but the protein and vector both lack histidine residues. In this case, the molecular biologist could use which of the following technique(s) to achieve purification?

A. Add a 6xHis-tag to the C-terminus of the protein
B. Amplify the histidine-encoding sequence by PCR and add it to the gene of interest
C. Add a series of histidine residues to the N-terminus of the protein
D. All of the choices are correct.


Answer: D

Biology & Microbiology

You might also like to view...

Which of the following do sticky ends and nucleic acid probes have in common?

A. They both are used as gene vectors in genetic engineering. B. They both involve complementary base pairing. C. They both are parts of RNA molecules. D. They both are produced by the action of restriction enzymes. E. They both are important aspects of bacterial sex.

Biology & Microbiology

Sxl protein mediates differential expression of genes further downstream in the developmental pathway

In females, active Sxl protein produced from Pm leads toproduction of proteins that facilitate female developmentā€”first Tra protein, which then, with Tra-2, facilitates splicing of the mRNA for active Dsx protein. In males: A. the absence of Sxl leads to a different splicing pattern of tra transcripts; a different version of Dsx isproduced that leads to male development. B. transcription from promoter Pe results in acharacteristic splicing pattern and the production of a burst of active Sxl protein. C. only stop codons are recognized, leading to splicing of Tra and overactivity of SxI. D. the start codons are preferentially removed in splicing, causing a premature termination of Dsx translation leading to male development.

Biology & Microbiology

What is the sequence of the DNA synthesized in the sequencing reaction?

You performed a Sanger sequencing reaction and obtained the following read. In this figure, A = green, C = purple, G = black, T = red. The height of the peaks is unimportant. The smallest molecule is at the left of the trace.



A) 5' TTTGCTTTGTGAGCGGATAACAA 3'
B) 3' TTTGCTTTGTGAGCGGATAACAA 5'
C) 5' AAACGAAACACTCGCCTATTGTT 3'
D) 3' AAACGAAACACTCGCCTATTGTT 5'

Biology & Microbiology

If you are not satisfied with your physician, ________

A) your insurance company requires you to stay with him or her B) it is too late to find a new one because you signed a contract C) you are allowed to find another one who better suits your needs D) you should go to the ER with every symptom

Biology & Microbiology