How would ecological efficiency change if all humans became vegetarians?
What will be an ideal response?
Since energy is lost at each trophic level, we would conserve more energy by consuming plants
directly. By including another trophic level (an herbivore) or even two more trophic levels (an
herbivore and a carnivore), more energy is lost and thus, efficiency is compromised.
You might also like to view...
Transmission and scanning electron microscopy differ because
A. transmission electron microscopy has high resolution, but scanning electron microscopy does not. B. transmission electron microscopy shows contrast, but scanning electron microscopy does not. C. transmission electron microscopy has much higher magnification than scanning electron microscopy. D. transmission electron microscopy shows two-dimensional ultrastructure, while the scanning electron microscopy shows three-dimensional structure. E. transmission electron microscopy uses light as an illumination source, while scanning electron microscopy uses electron beams as an illumination source.
By definition, a monophyletic lineage is a ____
a. clade b. taxon c. genus d. family e. phylogenetic tree
Which are the first three amino acids encoded by the wild-type sequence of gene B?
In frogs, green skin is determined by gene B. The wild-type sequence of the 5? end of the RNA-like strand of the entire first exon is shown below. The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin.
5? ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3?
The table of codons is provided here:
A) N-Thr-Gln-Ala…
B) N-Pro-Asn-Asn…
C) N-Met-Phe-Leu…
D) N-Ser-Ser-Val…
E) The correct sequence is not shown here.
Larger cells tend to
a. be long. b. be thin. c. have frilly surfaces. d. have folds that increase surface area. e. have any of these attributes.