Which of the following structures are associated with the immune system? Select all that may apply.A) thymusB) spleenC) lungsD) red bone marrowE) lymph nodesF) capillaries

What will be an ideal response?


A, B, D, E
The thymus, spleen, red bone marrow, and lymph nodes are all structures associated with immune system function.

Biology & Microbiology

You might also like to view...

Based on the gene and protein sequences that follow, what type of mutation-polypeptide effect has occurred?

Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A. base addition-silent B. base addition-none C. base addition-missense D. base addition-nonsense E. base addition-frameshift

Biology & Microbiology

In the Proterozoic eon, accumulated in the atmosphere that supported the first eukaryotes and multicellular organisms.

A. oxygen B. sulfur C. nitrogen D. hydrogen E. carbon dioxide

Biology & Microbiology

Swollen regions of underground stems that store starch are

A. stomata. B. tubers. C. always parasitic. D. rhizomes. E. tendrils.

Biology & Microbiology

Melanocytes use many enzymes to produce melanin. Based on their function, you would expect melanocytes in the skin to have a higher than usual number of

A) lysosomes. B) chloroplasts. C) ribosomes. D) microtubules.

Biology & Microbiology