Which of the following is true regarding bacterial genetics?
A. Bacteria are usually diploid organisms
B. Bacteria primarily reproduce sexually
C. The patterns of inheritance in bacteria are studied using different mechanisms than eukaryotes
D. Bacteria generally have linear chromosomes
C
You might also like to view...
The ________ bones are two small bones found at the corner of the eyes that have a duct system that drains tears from the eyes into the nasal chambers
A) lacrimal B) frontal C) occipital D) temporal
Certain proteins can bind to specific DNA regulatory sequences by entering
A. DNA's minor groove by using DNA polymerase and reading the nucleotide base pairs. B. the major groove of the DNA and reading the nucleotide base pairs. C. the major groove of RNA and reading the nucleotide base pairs. D. the minor groove of the DNA and reading the nucleotide base pairs. E. DNA's major groove by using DNA polymerase and reading the nucleotide base pairs.
Plants that are adapted to growing in flooded soils that are depleted of oxygen have:a
aerial roots. b. contractile roots. c. pneumatophores.
d. prop roots. e. buttress roots
You have the target DNA and primers shown below. You add the target DNA and primers, along with dATP, dTTP, dGTP, dCTP and Taq DNA polymerase to a test tube. After 30 cycles of PCR, which of the following is true about the DNA in your test tube?Target DNA: 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'Primer 1: 5' - GATCAA - 3'Primer 2: 5' - CGGAAA - 3'
A. There will be around a billion DNA molecules and most will look just like the template 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'. B. There will be around a billion DNA molecules and most will contain the region that is flanked by the primers 5' - GATCAATCAATGCCGAATTTCCG - 3' 3' - CTAGTTAGTTACGGCTTAAAGGC - 5'. C. Only the template and primers will be present; since no DNA helicase was added the strands won't separate so no new DNA can be made. D. There will be around a billion DNA molecules and most will be single stranded, either 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' OR 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'. E. There will be around a million DNA molecules of various sizes, depending on where chain termination occurred.