Mycobacterium leprae has a generation time of
A. 20 minutes.
B. 1 hour.
C. 6 hours.
D. 12 days.
D
You might also like to view...
One area where genomics has been applied to systems biology is the study of metabolism, by using genome sequencing and annotation to lead to predictions that can be tested by transcriptomics, proteomics, and metabolomics.
Answer the following statement true (T) or false (F)
Which are the first three amino acids encoded by the wild-type sequence of gene B?
In frogs, green skin is determined by gene B. The wild-type sequence of the 5? end of the RNA-like strand of the entire first exon is shown below. The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin.
5? ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3?
The table of codons is provided here:
A) N-Thr-Gln-Ala…
B) N-Pro-Asn-Asn…
C) N-Met-Phe-Leu…
D) N-Ser-Ser-Val…
E) The correct sequence is not shown here.
The proportion of white muscle fibers to red muscle fibers in sprinters is likely to ____
a. be lower than in marathon runners b. be higher than in marathon runners c. be equal to that in marathon runners d. depend most on the sex of the sprinter e. depend most on the age of the sprinter
Which of the following is NOT required for passive transport?
A. membranes B. concentration gradients C. molecules D. bilayers E. energy