In the 1700s, ____ classified organisms by their morphological similarities and differences, and in the 1800s, ____

provided the scientific rationale for the heritable basis of these morphological variations.



a. Mendel; Linnaeus
b. Darwin; Linnaeus
c. Linnaeus; Darwin
d. Linnaeus; Mendel
e. Mendel; Darwin


ANSWER: c

Biology & Microbiology

You might also like to view...

The only taxonomic category in which evolution can occur is the

a. genus. b. species. c. kingdom. d. family. e. class.

Biology & Microbiology

Cartilage that forms at the end of long bones and functions to allow bones to slide past each other during movement is called ________

A) elastic B) fibrocartilage C) bone D) hyaline

Biology & Microbiology

The degree of erosion in the United States is best described by the following statement.

A. Removal of trees helps build up topsoil and prevents erosion. B. There is a set amount of soil that was originally formed and erosion continually removes some of it; therefore we will one day run out of topsoil due to erosion. C. Farmland soil is eroding faster than it is being formed. D. Soil forms at generally the same rate as soil erodes, so there is an overall balance just as worldwide precipitation equals evaporation; it is just not evenly spread across the landscape.

Biology & Microbiology

The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI? A) two B) three C) four D) five

Biology & Microbiology