What removes Ca2+ from the inside of an axon terminal of a chemical synapse after an electrical impulse has passed?
a. ion channels
b. active transport pumps
c. passive carrier proteins
d. exocytosis
e. simple diffusion through the plasma membrane
ANSWER: b
You might also like to view...
Researchers surgically fuse two of the three ossicles in the inner ear of a mouse, effectively leaving two functional, linked ossicles in place of three. When the mouse's hearing is tested, what outcome would be expected? The mouse would be _____
A) more sensitive to sound, but only in the low-frequency range B) more sensitive to sound, but only in the high-frequency range C) more sensitive to sound in general D) less sensitive to sound in general
A paraphyletic group contains
A. a common ancestor but not all of its descendants. B. groups of species with different common ancestors. C. a common ancestor and all of its descendants. D. a common ancestor and all of its descendants but not the most recent common ancestor. E. every species ever derived from a common ancestor.
What is the correct pathway for a neural impulse?
a. Interneuron - motor - sensory b. Sensory - motor - interneuron c. Motor - sensory - interneuron d. Motor - sensory - interneuron e. Sensory - interneuron - motor
Which are the first three amino acids encoded by the wild-type sequence of gene B?
In frogs, green skin is determined by gene B. The wild-type sequence of the 5? end of the RNA-like strand of the entire first exon is shown below. The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin.
5? ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3?
The table of codons is provided here:
A) N-Thr-Gln-Ala…
B) N-Pro-Asn-Asn…
C) N-Met-Phe-Leu…
D) N-Ser-Ser-Val…
E) The correct sequence is not shown here.