If a chemical were to destroy all oocytes:
A) sperm would not form. B) eggs would form but have no chromosomes.
C) eggs would not form. D) sperm would form but have no chromosomes.
Answer: C
You might also like to view...
The sequence of gene B from another baby frog who is homozygous for allele b2 is shown. What effect does the mutation in allele b2 have on the protein?
5? AGGTCGCATAAATGTTCCTGTAATTTGG… 3? A) Allele b2 has a frameshift mutation—a deletion of one nucleotide resulting in a frameshift that changes all amino acids from that point on. B) Allele b2 has a deletion of one nucleotide outside of the coding region and there is no effect on the protein. C) Allele b2 has a missense mutation—a nucleotide substitution that changes one amino acid to another. D) Allele b2 has a nonsense mutation—a nucleotide substitution that forms a stop codon. E) Allele b2 has a silent mutation—a nucleotide substitution that does not change the protein.
The molecular switch that controls gene expression is known as:
a. the operon. b. controller. c. the operator. d. repressor. e. inducer.
List the properties of water.
What will be an ideal response?
Place the following steps of organogenesis in the correct order: (1 ) neural crest cells break away, (2 ) neural folds grow into a neural tube, (3 ) the notochord induces development of the neural plate
A) 2, 3, 1 B) 1, 2, 3 C) 1, 3, 2 D) 3, 2, 1 E) 3, 1, 2