If you observe a cell that contains organelles, then that cell is most likely a(n) prokaryote
__________________ Indicate whether the statement is true or false.
False - eukaryote
You might also like to view...
Identical twins have identical ____, but they do not always have identical ____
a. mitochondrial DNA; genotypes b. genotypes; mitochondrial DNA c. genotypes; phenotypes d. phenotypes; genotypes e. phenotypes; mitochondrial DNA
If the layer of wax was removed from the
surface of an apple while leaving the skin intact,
a. the apple would turn green. b. the apple would lose water and dehydrate. c. the apple would grow larger without that restriction. d. all of these would happen. e. nothing would happen
The epigenetic state of a cell is called its ____________________. Fill in the blank(s) with the appropriate word(s)
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below
AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI? A) two B) three C) four D) five