Explain the structure and function of the fontanels in an infant. At what age do they disappear?

What will be an ideal response?


The fontanels are membranous areas between the bones in the infant's skull. They allow the head to be flexible as it passes through the birth canal. They also allow for a rapid increase in the size of the brain as it grows. They are replaced by bone by age 2.

Biology & Microbiology

You might also like to view...

Weak bonds are important for the ______________ structure of proteins

A. primary B. secondary C. tertiary D. quarternary E. secondary, tertiary, AND quarternary

Biology & Microbiology

What causes the hypocotyl of dicots to

straighten? a. Light. b. Gravity. c. Wind. d. Air. e. All of these may be involved

Biology & Microbiology

Live weakened polio virus can be used directly in a(n)

A) inactivated whole-agent vaccine. B) attenuated whole-agent vaccine. C) conjugated vaccine. D) subunit vaccine. E) toxoid vaccine.

Biology & Microbiology

You have the target DNA and primers shown below. You add the target DNA and primers, along with dATP, dTTP, dGTP, dCTP and Taq DNA polymerase to a test tube. After 30 cycles of PCR, which of the following is true about the DNA in your test tube?Target DNA:        5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'Primer 1:                5' -  GATCAA - 3'Primer 2:                5' -  CGGAAA - 3'

A. There will be around a billion DNA molecules and most will look just like the template 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'. B. There will be around a billion DNA molecules and most will contain the region that is flanked by the primers 5' - GATCAATCAATGCCGAATTTCCG - 3' 3' - CTAGTTAGTTACGGCTTAAAGGC - 5'. C. Only the template and primers will be present; since no DNA helicase was added the strands won't separate so no new DNA can be made. D. There will be around a billion DNA molecules and most will be single stranded, either 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3'  OR 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5'.  E. There will be around a million DNA molecules of various sizes, depending on where chain termination occurred.

Biology & Microbiology